Enzymes associated to oral toxicity in haematopoietic cell transplantation


Salivary antioxidant enzymes associated to oral toxicity in haematopoietic cell transplantation: An observational analysis


Background: In haematopoietic cell transplantation (HCT), oral mucositis and xerostomia are related to conditioning-related oxidative stress. The perform of salivary antioxidant enzymes in oral toxicity is poorly described. The aim of this analysis was to substantiate the affiliation between salivary antioxidant enzymes and oral mucositis and xerostomia in HCT.


Design: Saliva from autologous and allogeneic HCT victims (n = 77) was chosen sooner than conditioning (T0), in the midst of the neutropenia interval (T1) and after marrow engraftment (T2). Salivary flow into, full salivary proteins, and superoxide dismutase, catalase and glutathione reductase actions had been measured.


Outcomes: There have been no vital variations in salivary flow into, full salivary proteins and catalase on the three HCT time components. Glutathione reductase ranges had been diminished at T1 compared with T0 (P = .013) and T2 (P = .001). Superoxide dismutase ranges had been elevated from T0 to T2 (P = .013). Neither of these enzymes was associated to oral mucositis. Elevated superoxide dismutase ranges had been associated to xerostomia frequency. Ranges of this enzyme moreover confirmed vital correlation with days of xerostomia in T2 (ρ = .40, P = .002).


Conclusions: Salivary antioxidant enzymes modified sooner than and thru early durations after HCT. The rise in salivary superoxide dismutase suggested partial activation of the salivary antioxidant system and was associated to xerostomia.




mRNA-Decapping Enzyme 1B (DCP1B) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

mRNA-Decapping Enzyme 1B (DCP1B) Antibody

abx232270-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Human mRNA-decapping enzyme 1B (DCP1B)

  • EUR 1298.00
  • EUR 682.00
  • EUR 798.00
  • 1MG
  • 200ug
  • 500ug
  • MW: 81.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human mRNA-decapping enzyme 1B(DCP1B) expressed in in vitro E.coli expression system

Mouse mRNA- decapping enzyme 1B, Dcp1b ELISA KIT

ELI-28140m 96 Tests
EUR 865

Human mRNA-Decapping Enzyme 1B (DCP1B) ELISA Kit

abx386810-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Bovine mRNA- decapping enzyme 1B, DCP1B ELISA KIT

ELI-32403b 96 Tests
EUR 928

Human mRNA- decapping enzyme 1B, DCP1B ELISA KIT

ELI-48379h 96 Tests
EUR 824

DCP1B antibody

70R-16758 50 ul
EUR 435
Description: Rabbit polyclonal DCP1B antibody

DCP1B Antibody

DF12929 200ul
EUR 304
Description: DCP1B Antibody detects endogenous levels of DCP1B.

DCP1B Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DCP1B. Recognizes DCP1B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

DCP1B antibody

70R-8999 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal DCP1B antibody


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA27678 50 ug
EUR 363
Description: Mouse polyclonal to DCP1B

DCP1B Blocking Peptide

33R-9166 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DCP1B antibody, catalog no. 70R-8999

DCP1B Blocking Peptide

DF12929-BP 1mg
EUR 195

DCP1B cloning plasmid

CSB-CL811635HU-10ug 10ug
EUR 629
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1857
  • Sequence: atggcagccgtggcggcaggcggcctggtgggaaaggggcgcgacatcagcctagcggccctgcagcgccacgacccctatatcaaccgcatcgtggacgtggccagccaggtggctctgtacaccttcggccatcgggccaacgagtgggagaaaactgatgtggaaggaacct
  • Show more
Description: A cloning plasmid for the DCP1B gene.

anti- DCP1B antibody

FNab02270 100µg
EUR 548.75
  • Immunogen: DCP1 decapping enzyme homolog B(S. cerevisiae)
  • Uniprot ID: Q8IZD4
  • Gene ID: 196513
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against DCP1B

Anti-DCP1B antibody

PAab02270 100 ug
EUR 386

Recombinant Human mRNA-decapping enzyme 1B Protein, His, Yeast-100ug

QP9835-ye-100ug 100ug
EUR 670

Recombinant Human mRNA-decapping enzyme 1B Protein, His, Yeast-10ug

QP9835-ye-10ug 10ug
EUR 308

Recombinant Human mRNA-decapping enzyme 1B Protein, His, Yeast-1mg

QP9835-ye-1mg 1mg
EUR 2747

Recombinant Human mRNA-decapping enzyme 1B Protein, His, Yeast-200ug

QP9835-ye-200ug 200ug
EUR 1069

Recombinant Human mRNA-decapping enzyme 1B Protein, His, Yeast-500ug

QP9835-ye-500ug 500ug
EUR 1804

Recombinant Human mRNA-decapping enzyme 1B Protein, His, Yeast-50ug

QP9835-ye-50ug 50ug
EUR 417

Human mRNA-decapping enzyme 1A (DCP1A)

  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 67.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human mRNA-decapping enzyme 1A(DCP1A) expressed in E.coli

mRNA-Decapping Enzyme 1A (DCP1A) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

mRNA-Decapping Enzyme 1A (DCP1A) Antibody

abx010640-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

mRNA-Decapping Enzyme 1A (DCP1A) Antibody

abx216929-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

MRNA-Decapping Enzyme 1A (DCP1A) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

MRNA-Decapping Enzyme 1A (DCP1A) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

mRNA-Decapping Enzyme 1A (Dcp1a) Antibody

abx037749-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

mRNA-Decapping Enzyme 1A (DCP1A) Antibody

  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

mRNA-Decapping Enzyme 1A (DCP1A) Antibody

abx029355-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

mRNA-Decapping Enzyme 1A (DCP1A) Antibody

abx029355-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

MRNA-Decapping Enzyme 1A (DCP1A) Antibody

abx331753-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

MRNA-Decapping Enzyme 1A (DCP1A) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

mRNA-Decapping Enzyme 1A (DCP1A) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

mRNA-Decapping Enzyme 1A (DCP1A) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

mRNA-Decapping Enzyme 1A (DCP1A) Antibody

abx432194-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

mRNA-Decapping Enzyme 1A (DCP1A) Antibody

abx232269-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.


EF009027 96 Tests
EUR 689

Human DCP1B shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DCP1B Recombinant Protein (Human)

RP008836 100 ug Ask for price

DCP1B Recombinant Protein (Mouse)

RP128126 100 ug Ask for price

DCP1B ORF Vector (Human) (pORF)

ORF002946 1.0 ug DNA
EUR 95

Dcp1b ORF Vector (Mouse) (pORF)

ORF042710 1.0 ug DNA
EUR 506

Recombinant Human mRNA-decapping enzyme 1B Protein, His-B2M, Invitro-E.coli-100ug

QP9835-iv-100ug 100ug
EUR 1613

Recombinant Human mRNA-decapping enzyme 1B Protein, His-B2M, Invitro-E.coli-10ug

QP9835-iv-10ug 10ug
EUR 816

Recombinant Human mRNA-decapping enzyme 1B Protein, His-B2M, Invitro-E.coli-50ug

QP9835-iv-50ug 50ug
EUR 516

Human mRNA- decapping enzyme 2, DCP2 ELISA KIT

ELI-09113h 96 Tests
EUR 824

Mouse mRNA- decapping enzyme 1A, Dcp1a ELISA KIT

ELI-26330m 96 Tests
EUR 865

Mouse mRNA- decapping enzyme 2, Dcp2 ELISA KIT

ELI-26523m 96 Tests
EUR 865

Human mRNA-Decapping Enzyme 1A (DCP1A) ELISA Kit

abx386809-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human mRNA- decapping enzyme 1A, DCP1A ELISA KIT

ELI-47012h 96 Tests
EUR 824

DCP1B sgRNA CRISPR Lentivector set (Human)

K0566401 3 x 1.0 ug
EUR 339

Dcp1b sgRNA CRISPR Lentivector set (Mouse)

K3596801 3 x 1.0 ug
EUR 339

Human Scavenger mRNA- decapping enzyme DcpS, DCPS ELISA KIT

ELI-08941h 96 Tests
EUR 824

Bovine Scavenger mRNA- decapping enzyme DcpS, DCPS ELISA KIT

ELI-26524b 96 Tests
EUR 928

Porcine Scavenger mRNA- decapping enzyme DcpS, DCPS ELISA KIT

ELI-07878p 96 Tests
EUR 928

Rat Scavenger mRNA- decapping enzyme DcpS, Dcps ELISA KIT

ELI-32404r 96 Tests
EUR 886

Mouse Scavenger mRNA- decapping enzyme DcpS, Dcps ELISA KIT

ELI-48380m 96 Tests
EUR 865

DCP1B sgRNA CRISPR Lentivector (Human) (Target 1)

K0566402 1.0 ug DNA
EUR 154

DCP1B sgRNA CRISPR Lentivector (Human) (Target 2)

K0566403 1.0 ug DNA
EUR 154

DCP1B sgRNA CRISPR Lentivector (Human) (Target 3)

K0566404 1.0 ug DNA
EUR 154

Dcp1b sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3596802 1.0 ug DNA
EUR 154

Dcp1b sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3596803 1.0 ug DNA
EUR 154

Dcp1b sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3596804 1.0 ug DNA
EUR 154

DCP1B 3'UTR Luciferase Stable Cell Line

TU005629 1.0 ml
EUR 1394

Dcp1b 3'UTR GFP Stable Cell Line

TU154905 1.0 ml Ask for price

Dcp1b 3'UTR Luciferase Stable Cell Line

TU104905 1.0 ml Ask for price

Dcp1b 3'UTR Luciferase Stable Cell Line

TU203203 1.0 ml Ask for price

Dcp1b 3'UTR GFP Stable Cell Line

TU253203 1.0 ml Ask for price

DCP1B 3'UTR GFP Stable Cell Line

TU055629 1.0 ml
EUR 1394

DCP1B Protein Vector (Mouse) (pPB-C-His)

PV170838 500 ng
EUR 603

DCP1B Protein Vector (Mouse) (pPB-N-His)

PV170839 500 ng
EUR 603

DCP1B Protein Vector (Mouse) (pPM-C-HA)

PV170840 500 ng
EUR 603

DCP1B Protein Vector (Mouse) (pPM-C-His)

PV170841 500 ng
EUR 603

DCP1B Protein Vector (Human) (pPB-C-His)

PV011781 500 ng
EUR 329

DCP1B Protein Vector (Human) (pPB-N-His)

PV011782 500 ng
EUR 329

DCP1B Protein Vector (Human) (pPM-C-HA)

PV011783 500 ng
EUR 329

DCP1B Protein Vector (Human) (pPM-C-His)

PV011784 500 ng
EUR 329

Recombinant Human mRNA-decapping enzyme 1A Protein, His, E.coli-100ug

QP8201-ec-100ug 100ug
EUR 571

Recombinant Human mRNA-decapping enzyme 1A Protein, His, E.coli-10ug

QP8201-ec-10ug 10ug
EUR 272

Recombinant Human mRNA-decapping enzyme 1A Protein, His, E.coli-1mg

QP8201-ec-1mg 1mg
EUR 2303

Recombinant Human mRNA-decapping enzyme 1A Protein, His, E.coli-200ug

QP8201-ec-200ug 200ug
EUR 898

Recombinant Human mRNA-decapping enzyme 1A Protein, His, E.coli-500ug

QP8201-ec-500ug 500ug
EUR 1514

Recombinant Human mRNA-decapping enzyme 1A Protein, His, E.coli-50ug

QP8201-ec-50ug 50ug
EUR 362

pPACK-ID: Integrase-defective lentiviral packaging mix (15 reactions)

LV520A-ID 15 reactions
EUR 697
  • Category: Lentiviral Technology

pPACK-ID: Integrase-defective lentiviral packaging mix (30 reactions)

LV525A-ID 30 reactions
EUR 1132
  • Category: Lentiviral Technology

Decapping Enzyme, Scavenger (Recombinant)

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Recombinant Human Decapping Enzyme, Scavenger

7-02632 2µg Ask for price

Recombinant Human Decapping Enzyme, Scavenger

7-02633 10µg Ask for price

Recombinant Human Decapping Enzyme, Scavenger

7-02634 1mg Ask for price

Decapping Enzyme, Scavenger (DCPS) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Decapping Enzyme, Scavenger (DCPS) Antibody

abx029282-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Decapping Enzyme, Scavenger (DCPS) Antibody

abx029282-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Enhancer of mRNA-Decapping 3 (EDC3) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Enhancer Of mRNA-Decapping 4 (EDC4) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Enhancer of mRNA-Decapping 3 (EDC3) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.



Tubulin modifying enzymes as objective for the remedy of tau-related illnesses


  • Inside the thoughts of victims with Alzheimer’s sickness (AD), the amount and dimension of microtubules (MTs) are significantly and selectively diminished. MTs are involved in quite a lot of cell options, and defects of the microtubular system have emerged as a unifying hypothesis for the heterogeneous and variable medical exhibits of AD.


  • MTs orchestrate their fairly a couple of options by the use of the spatiotemporal regulation of the binding of specialised microtubule-associated proteins (MAPs) and molecular motors. Covalent posttranslational modifications (PTMs) on the tubulin C-termini that protrude on the ground of MTs regulate the binding of these effectors.


  • In neurons, MAP tau may be very appreciable and its irregular dissociation from MTs throughout the axon, cell mislocalization and hyperphosphorylation, are most important events leading to neuronal dying. Consequently, compounds concentrating on tau phosphorylation or aggregation are at current evaluated nonetheless their medical significance has not been demonstrated On this evaluation, we deal with the rising hyperlink between tubulin PTMs and tau dysfunction. In neurons, extreme ranges of glutamylation and detyrosination profoundly impression the physicochemical properties on the ground of MTs.


  • Moreover, in victims with early-onset progressive neurodegeneration, deleterious mutations in enzymes involved in modifying MTs on the ground have simply currently been acknowledged, underscoring the importance of this enzymatic tools in neurology. We postulate that pharmacologically concentrating on the tubulin-modifying enzymes holds promise as therapeutic technique for the remedy of neurodegenerative illnesses.


Organoarsenicals inhibit bacterial peptidoglycan biosynthesis by concentrating on the vital enzymeMurA

Trivalent organoarsenicals similar to methylarsenite (MAs(III)) are considerably further toxic than inorganic arsenate (As(V)) or arsenite (As(III)). In microbial communities MAs(III) reveals vital antimicrobial train. Although MAs(III) and completely different organoarsenicals contribute to the worldwide arsenic biogeocycle, how they exert antibiotic-like properties is mainly unknown. To find out attainable targets of MAs(III), a genomic library of the gram-negative bacterium,


Shewanellaputrefaciens 200, was expressed in Escherichia coli with selection for MAs(III) resistance. One clone contained the S. putrefaciensmurA gene (SpmurA), which catalyzes the first devoted step in peptidoglycan biosynthesis. Overexpression of SpmurA conferred MAs(III) resistance to E. coli.


Purified SpMurA was inhibited by MAs(III), phenylarsenite (PhAs(III)) or the phosphonate antibiotic fosfomycin nonetheless not by inorganic As(III). Fosfomycin inhibits MurA by binding to a conserved residue that corresponds to Cys117 in SpMurA. A C117D mutant was proof in opposition to fosfomycin nonetheless remained delicate to MAs(III), indicating that the two compounds have completely completely different mechanisms of movement. New inhibitors of peptidoglycan biosynthesis are extraordinarily wished as antimicrobial medicine, and organoarsenicals characterize a new house for the occasion of novel compounds for combating the specter of antibiotic resistance.


Human Endothelin Converting Enzyme 1 (ECE1) ELISA Kit

RDR-ECE1-Hu-96Tests 96 Tests
EUR 692

Human Endothelin Converting Enzyme 1 (ECE1) ELISA Kit

RD-ECE1-Hu-48Tests 48 Tests
EUR 478

Human Endothelin Converting Enzyme 1 (ECE1) ELISA Kit

RD-ECE1-Hu-96Tests 96 Tests
EUR 662

Endothelin Converting Enzyme 1 (ECE1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Endothelin Converting Enzyme 1 (ECE1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Endothelin Converting Enzyme 1 (ECE1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Endothelin Converting Enzyme 1 (ECE1) Antibody

  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Endothelin Converting Enzyme 1 (ECE1) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Endothelin Converting Enzyme 1 (ECE1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Endothelin Converting Enzyme 1 (ECE1) Antibody

abx145201-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Endothelin Converting Enzyme 1 (ECE1) Antibody

  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

Endothelin Converting Enzyme 1 (ECE1) Antibody

abx033018-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Endothelin Converting Enzyme 1 (ECE1) Antibody

abx033018-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Endothelin Converting Enzyme 1 (ECE1) Antibody

abx033019-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Endothelin Converting Enzyme 1 (ECE1) Antibody

abx033019-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Endothelin Converting Enzyme 1 (ECE1) Antibody

abx033020-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Endothelin Converting Enzyme 1 (ECE1) Antibody

abx033020-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Endothelin Converting Enzyme 1 (ECE1) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant Endothelin Converting Enzyme 1 (ECE1)

  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P42892
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Endothelin Converting Enzyme 1 expressed in: E.coli

Recombinant Endothelin Converting Enzyme 1 (ECE1)

  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q4PZA2
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 33.3kDa
  • Isoelectric Point: 6.2
Description: Recombinant Mouse Endothelin Converting Enzyme 1 expressed in: E.coli

Recombinant Endothelin Converting Enzyme 1 (ECE1)

  • EUR 521.12
  • EUR 242.00
  • EUR 1679.20
  • EUR 626.40
  • EUR 1152.80
  • EUR 412.00
  • EUR 4048.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P42893
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 30.8kDa
  • Isoelectric Point: 6
Description: Recombinant Rat Endothelin Converting Enzyme 1 expressed in: E.coli

Rat Endothelin Converting Enzyme 1 (ECE1) Protein

  • EUR 732.00
  • EUR 286.00
  • EUR 2263.00
  • EUR 871.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Endothelin Converting Enzyme 1 (ECE1) Protein

  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Mouse Endothelin Converting Enzyme 1 (ECE1) Protein

  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Recombinant Human Endothelin-converting Enzyme 1/ECE-1 (N-8His)

C600-10ug 10ug
EUR 202
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Human Endothelin-converting Enzyme 1/ECE-1 (N-8His)

C600-1mg 1mg
EUR 2486
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Human Endothelin-converting Enzyme 1/ECE-1 (N-8His)

C600-500ug 500ug
EUR 1755
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Human Endothelin-converting Enzyme 1/ECE-1 (N-8His)

C600-50ug 50ug
EUR 496
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Human Endothelin Converting Enzyme 1 (ECE1) CLIA Kit

abx195549-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Endothelin Converting Enzyme 1 (ECE1) CLIA Kit

abx195550-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Endothelin Converting Enzyme 1 (ECE1) ELISA Kit

  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Endothelin Converting Enzyme 1 (ECE1) ELISA Kit

abx255328-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Endothelin Converting Enzyme 1 (ECE1) ELISA Kit

abx251819-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human ECE1(Endothelin-converting enzyme 1) ELISA Kit

EH2454 96T
EUR 524.1
  • Detection range: 31.25-2000 pg/ml
  • Uniprot ID: P42892
  • Alias: ECE1/ECE/ECE-1/endothelin converting enzyme 1/endothelin-converting enzyme 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human ECE1/ Endothelin-converting enzyme 1 ELISA Kit

E0751Hu 1 Kit
EUR 605

Human Endothelin- converting enzyme 1, ECE1 ELISA KIT

ELI-08694h 96 Tests
EUR 824

Mouse Endothelin- converting enzyme 1, Ece1 ELISA KIT

ELI-09365m 96 Tests
EUR 865

Rat Endothelin-converting enzyme 1(ECE1) ELISA kit

CSB-EL007371RA-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Rat Endothelin-converting enzyme 1 (ECE1) in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat Endothelin-converting enzyme 1(ECE1) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Rat Endothelin-converting enzyme 1(ECE1) in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Monkey Endothelin Converting Enzyme 1 (ECE1) ELISA Kit

abx359989-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Endothelin Converting Enzyme 1 (ECE1) ELISA Kit

abx361861-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Endothelin Converting Enzyme 1 (ECE1) ELISA Kit

abx362668-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Endothelin Converting Enzyme 1 (ECE1) ELISA Kit

abx356951-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Sheep Endothelin Converting Enzyme 1 (ECE1) ELISA Kit

abx364544-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Cow Endothelin Converting Enzyme 1 (ECE1) ELISA Kit

abx521037-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Endothelin Converting Enzyme 1 (ECE1) ELISA Kit

abx521040-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human Endothelin Converting Enzyme 1 (ECE1) ELISA Kit

abx575487-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Endothelin Converting Enzyme 1 (ECE1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse ECE1(Endothelin Converting Enzyme 1) ELISA Kit

EM0995 96T
EUR 524.1
  • Detection range: 15.625-1000 pg/ml
  • Uniprot ID: Q4PZA2
  • Alias: ECE1/EC 3.4.24/EC converting enzyme 1/endothelin-converting enzyme 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 9.375pg/ml

Bovine Endothelin- converting enzyme 1, ECE1 ELISA KIT

ELI-47154b 96 Tests
EUR 928

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Human)

  • EUR 232.00
  • EUR 2285.00
  • EUR 574.00
  • EUR 289.00
  • EUR 208.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ECE1 (Leu469~Glu721)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin Converting Enzyme 1 (ECE1)

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Mouse)

  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ECE1 (Ala326~Asn577)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelin Converting Enzyme 1 (ECE1)

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Rat)

  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ECE1 (His214~Ala448)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelin Converting Enzyme 1 (ECE1)

Human Endothelin Converting Enzyme 1 ELISA Kit (ECE1)

RK01292 96 Tests
EUR 521

Human Endothelin Converting Enzyme 1 (ECE1) ELISA Kit

SEA483Hu-10x96wellstestplate 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin Converting Enzyme 1 (ECE1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Endothelin Converting Enzyme 1 (ECE1) in serum, plasma and other biological fluids.

Human Endothelin Converting Enzyme 1 (ECE1) ELISA Kit

SEA483Hu-1x48wellstestplate 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin Converting Enzyme 1 (ECE1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Endothelin Converting Enzyme 1 (ECE1) in serum, plasma and other biological fluids.

Human Endothelin Converting Enzyme 1 (ECE1) ELISA Kit

SEA483Hu-1x96wellstestplate 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin Converting Enzyme 1 (ECE1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Endothelin Converting Enzyme 1 (ECE1) in serum, plasma and other biological fluids.

Human Endothelin Converting Enzyme 1 (ECE1) ELISA Kit

SEA483Hu-5x96wellstestplate 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin Converting Enzyme 1 (ECE1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Endothelin Converting Enzyme 1 (ECE1) in serum, plasma and other biological fluids.

Human Endothelin Converting Enzyme 1 (ECE1) ELISA Kit

  • EUR 4324.00
  • EUR 2283.00
  • EUR 586.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Endothelin Converting Enzyme 1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Endothelin Converting Enzyme 1 (ECE1) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

CLIA kit for Human ECE1 (Endothelin Converting Enzyme 1)

E-CL-H1101 1 plate of 96 wells
EUR 584
  • Gentaur's ECE1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human ECE1 . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human ECE1 (Endothelin Converting Enzyme 1) in samples from Serum, Plasma, Cell supernatant

CLIA kit for Mouse ECE1 (Endothelin Converting Enzyme 1)

E-CL-M0280 1 plate of 96 wells
EUR 584
  • Gentaur's ECE1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Mouse ECE1 . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Mouse ECE1 (Endothelin Converting Enzyme 1) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human ECE1 (Endothelin Converting Enzyme 1)

E-EL-H1759 1 plate of 96 wells
EUR 534
  • Gentaur's ECE1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ECE1. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human ECE1 (Endothelin Converting Enzyme 1) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Mouse ECE1 (Endothelin Converting Enzyme 1)

E-EL-M0458 1 plate of 96 wells
EUR 534
  • Gentaur's ECE1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse ECE1. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse ECE1 (Endothelin Converting Enzyme 1) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human ECE1 (Endothelin Converting Enzyme 1)

ELK2398 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Endothelin Converting Enzyme 1 (ECE1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
  • Show more
Description: A sandwich ELISA kit for detection of Endothelin Converting Enzyme 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Endothelin-converting enzyme 1 (ECE1)

KTE61959-48T 48T
EUR 332
  • Endothelin converting enzyme 1, also known as ECE1, is a enzyme which in humans is encoded by the ECE1 gene.Endothelin-converting enzyme-1 is involved in the proteolytic processing of endothelin-1 (EDN1), -2 (EDN2), and -3 (EDN3) to biologically acti
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Endothelin-converting enzyme 1 (ECE1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Endothelin-converting enzyme 1 (ECE1)

KTE61959-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Endothelin converting enzyme 1, also known as ECE1, is a enzyme which in humans is encoded by the ECE1 gene.Endothelin-converting enzyme-1 is involved in the proteolytic processing of endothelin-1 (EDN1), -2 (EDN2), and -3 (EDN3) to biologically acti
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Endothelin-converting enzyme 1 (ECE1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Endothelin-converting enzyme 1 (ECE1)

KTE61959-96T 96T
EUR 539
  • Endothelin converting enzyme 1, also known as ECE1, is a enzyme which in humans is encoded by the ECE1 gene.Endothelin-converting enzyme-1 is involved in the proteolytic processing of endothelin-1 (EDN1), -2 (EDN2), and -3 (EDN3) to biologically acti
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Endothelin-converting enzyme 1 (ECE1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Human), APC

  • EUR 323.00
  • EUR 2969.00
  • EUR 836.00
  • EUR 409.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ECE1 (Leu469~Glu721)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with APC.

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Human), Biotinylated

  • EUR 295.00
  • EUR 2235.00
  • EUR 671.00
  • EUR 358.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ECE1 (Leu469~Glu721)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with Biotin.

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Human), Cy3

  • EUR 390.00
  • EUR 3917.00
  • EUR 1073.00
  • EUR 504.00
  • EUR 239.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ECE1 (Leu469~Glu721)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with Cy3.

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Human), FITC

  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ECE1 (Leu469~Glu721)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with FITC.

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Human), HRP

  • EUR 297.00
  • EUR 2589.00
  • EUR 741.00
  • EUR 371.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ECE1 (Leu469~Glu721)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with HRP.

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Human), PE

  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ECE1 (Leu469~Glu721)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with PE.

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Mouse), APC

  • EUR 329.00
  • EUR 3041.00
  • EUR 854.00
  • EUR 416.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ECE1 (Ala326~Asn577)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with APC.

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 299.00
  • EUR 2288.00
  • EUR 684.00
  • EUR 363.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ECE1 (Ala326~Asn577)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with Biotin.

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Mouse), Cy3

  • EUR 397.00
  • EUR 4013.00
  • EUR 1097.00
  • EUR 513.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ECE1 (Ala326~Asn577)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with Cy3.

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Mouse), FITC

  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ECE1 (Ala326~Asn577)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with FITC.

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Mouse), HRP

  • EUR 302.00
  • EUR 2652.00
  • EUR 756.00
  • EUR 377.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ECE1 (Ala326~Asn577)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with HRP.

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Mouse), PE

  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ECE1 (Ala326~Asn577)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with PE.

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Rat), APC

  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ECE1 (His214~Ala448)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with APC.

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Rat), Biotinylated

  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ECE1 (His214~Ala448)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with Biotin.

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Rat), Cy3

  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ECE1 (His214~Ala448)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with Cy3.

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Rat), FITC

  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ECE1 (His214~Ala448)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with FITC.

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Rat), HRP

  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ECE1 (His214~Ala448)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with HRP.

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Rat), PE

  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ECE1 (His214~Ala448)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with PE.

Ece1 ELISA Kit| Rat Endothelin-converting enzyme 1 ELISA Kit

EF018637 96 Tests
EUR 689

ECE1 ELISA Kit| Mouse Endothelin Converting Enzyme 1 ELISA Kit

EF013575 96 Tests
EUR 689

ECE1 ELISA Kit| Bovine Endothelin-converting enzyme 1 ELISA Kit

EF011351 96 Tests
EUR 689

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Human), APC-Cy7

  • EUR 527.00
  • EUR 5818.00
  • EUR 1552.00
  • EUR 698.00
  • EUR 301.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ECE1 (Leu469~Glu721)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with APC-Cy7.

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 538.00
  • EUR 5962.00
  • EUR 1588.00
  • EUR 713.00
  • EUR 304.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ECE1 (Ala326~Asn577)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with APC-Cy7.

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Rat), APC-Cy7

  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ECE1 (His214~Ala448)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with APC-Cy7.

Anti-Angiotensin Converting Enzyme 1/ACE Antibody

PA2196-1 100ug/vial
EUR 334

Mouse Endothelin-converting enzyme-like 1 (Ecel1)

  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 13.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Endothelin-converting enzyme-like 1(Ecel1),partial expressed in E.coli

Endothelin Converting Enzyme Like 1 (ECEL1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Endothelin Converting Enzyme Like 1 (ECEL1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Endothelin Converting Enzyme Like 1 (ECEL1) Antibody

abx232621-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Human Endothelin converting enzyme 1 ELISA kit

E01E0169-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Endothelin converting enzyme 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.


Leave a Reply

Your email address will not be published. Required fields are marked *